EST 1785388 is a singleton


Sequence

>1785388 (1 EST) Length=177 AAACACACAAATCATGGGGACAATGAAGGGCAGTAACAATTACAAAGGCAGTCTTCTGCAGGACACTTTCTATGCTTTGC AAACCAATCGCGCAGGTGGGACCAGTGCCCCCCATGCAGACATACGGTACAACANGTGAAGGAGGAATCAACGTCGTAGC CACTCGCAAGGGCAAAC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 1785388: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17853883293894AI046261TENU1131T. cruzi epimastigote normalized cDNA Library


Date: 15:19:3 on Fri 24 Nov 117.