EST 1785397 is a singleton


Sequence

>1785397 (1 EST) Length=165 CTTCAACTTAACCGCCGCATTCCAACAAGTAGAAAGAAACAAACAGGAAATAATAAAAAATTGGTCCTTCATTTTCGTCT CGTCTTGTTATCAGCAGCGCGCAGTAAATTCACCTGTGCCCTTGTTAGAGCAGTCCGCTGCATTCCATGCATAGTGGCCG CGTAG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1785397: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17853973293903AI046270TENU1140T. cruzi epimastigote normalized cDNA Library


Date: 15:14:50 on Wed 22 Nov 117.