EST 1785400 is a singleton


Sequence

>1785400 (1 EST) Length=363 GTATGGGTGCAACGTCGTCGTGTGTAGCCCGGCGTGGTGGCGGTGGTATCTCTCTCTCTCTCTGTCTGTCTGTCTGTGTG TGCGTGTGGGTCCCGCCCCCTCAACTGGATGGCTGTTCATCCGTCCAGAGGTTCAAATTGTCGCGCACAGGCGCACAATG AGGTTCGACTCGCGGTACCCTCGTCATCAAGGGTCTCGAGCTCCGTGACGGCCTCATCGTACGCCTGGCGCGCAACTGAA AGCCCTTCTCATGCTCCTTCATGATCTCGTAGTAAAAGACAGAGAAGTTCAGCGCAAGGCCAAGACGTATCGGGTGCGTC GACGCGAGTGATGAATTCGCCACCTCCGTCGCCTTTGCGTATG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1785400: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17854003293906AI046273TENU1143T. cruzi epimastigote normalized cDNA Library


Date: 1:44:6 on Sun 19 Nov 117.