EST 1785416 is a singleton


Sequence

>1785416 (1 EST) Length=222 CCCCCGAAGTGCCATGGGAATTTCATTGTTGCTGTAAGGATCGACGTGACAGCGGATATCACATTCCTCCCCATTGAACA AATTCATTTCGTTCCATTCGTTTCCTTGATTCTTTTCGTATCTCCTGCGCGCCAAGGTACAGTCGTTCCACCTGCTGCTC TAACATCTCCTGATTTACCCGCGGGACCTCGGCTCGTTCACTCTGTTCAAGAGCAGAGAGAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1785416: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17854163293922AI046289TENU1159T. cruzi epimastigote normalized cDNA Library


Date: 10:2:39 on Fri 24 Nov 117.