EST 1785419 is a singleton


Sequence

>1785419 (1 EST) Length=204 CTGGGCAAAGTTCNCAACGTCAACCATGATGTCGTATTGAACAAAAATGGTGCCCGTCTGCGGTACAAGGCCGAAAGCAG AAAGAACCACCACACGGTTCTTTTCGCGTTTGGTGGAAAAATCTTTTCGCGCGGCATCCAACATAATCTTGTCAAATTGA GCACACAGACGCTCTCGGTCCTCATCCTTGTCCTGCACAGAGGC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1785419: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17854193293925AI046027TENU1162T. cruzi epimastigote normalized cDNA Library


Date: 10:45:34 on Sat 18 Nov 117.