EST 1785435 is a singleton


Sequence

>1785435 (1 EST) Length=361 GGTCACCCCATACTGCACTGGGCTCTTGTCAAGCATCACATTCTTGCGGGCAATTAAGGCCCAATGAATTACCCCGTTAA AGATGCCACGAATGGTCGCAGCGCATACACCGTCGCTCTCTGCCTTAACGGCCCCCACAAATGGTAAAATAGCCGTCCAC TCATCCAAATGCTCCTCCGAGCGCTGCTGCAGGATGGTCGGCAGTCGCAGACGAAAGCCTTGTGAGAAACCCAAAGAGAG GTGCGCACGGGACTCCAACAAATCAAAGTTATACCCACATGCCACCATCGTGTTGGGCGCCATACGCTGATAAAACGCCA CTCGAGCCGCGTTCCAAGCATCGTGTGCACGCACCATCTTC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1785435: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17854353293941AI046043TENU1079T. cruzi epimastigote normalized cDNA Library


Date: 23:0:11 on Fri 24 Nov 117.