EST 1785452 is a singleton


Sequence

>1785452 (1 EST) Length=184 CCAATGTACAGGTGCAAGACAATTATCTACACAAAAAGAAACATACATGCAACAGCAACAAAAACAAAAAGGGTGGGAAA AGTGAAAGGAAAATAAAAGTGTTCTGTCTTCTCTCACAGAAAGAGACAAGAGGAAGTAAGATGTGCACATGGACACATGC GTCTTATTTTATCCATTGATAAGA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1785452: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17854523293958AI046060TENU1096T. cruzi epimastigote normalized cDNA Library


Date: 4:38:32 on Thu 23 Nov 117.