EST 1785453 is a singleton


Sequence

>1785453 (1 EST) Length=164 GTACTTGGGTGGGGTGGTTTTNTGTTTGGTTGTTGTTTTACATATATTATCTTACCAGCAATTGTGGCTACATCGTATGT GGCGTTGGTAGGCGACGATGGAATTTGGGCAGCGTTGATAAGTGGCCCCATATTTTTNCTTTTCTTGTCCTTTTGGCCGG ATTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1785453: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17854533293959AI046061TENU1097T. cruzi epimastigote normalized cDNA Library


Date: 2:36:4 on Wed 22 Nov 117.