EST 1785457 is a singleton


Sequence

>1785457 (1 EST) Length=225 GCAAAACGGTGTAGACAGTCCAAATCACTGGATTGCCGCCCCTCGCCCACACAGCGGCCGGCGCAGGGGGAAAACAACAA CAACAAAGAAAAAGAAAAAGGGAATTTATAATGCCACACGTATAAGTTTTTTAATTTGAAAGGGAGTATATATATATGGA CATGCACCCATCATTTTAAATGGCACGACCACGTTGCGTACCGTGTGATGTTTTCTCTTTCATGA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1785457: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17854573293963AI046065TENU1101T. cruzi epimastigote normalized cDNA Library


Date: 23:6:22 on Fri 24 Nov 117.