EST 1785465 is a singleton


Sequence

>1785465 (1 EST) Length=392 CACGCACAAATAGCCTTGTTTCGCATTGAATAGTCATCATGGAGACAGCGCCAATGAAGCACAAAATCTACGCCAAAGAA AAAGCAAAGAGTAAATGCGGCACCAGTTTCATAAAGAAGACAAGAAAAAAAAAAGGCAGAAGTTGGCACAGTTGGGAATC AATGCCTTTGGTGGCATTCTCGTTGCATACACAGAGACACGCTTCCAGCAAAGTCACCATACATTCCAAAAAGAGCGTTA AGATGACAAACCCGCAATAAAAAGGTTTAGCAGATCAACTTTCGGAAGGAAACACACGCATTTTAAGGTGTTCCGTCGCC ACAGAAAGTTGAGCAAAGGTTGGTACAAACGCACGCAAATGGGTCCCACGCTCCAACTCAAATGACAACAGA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1785465: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17854653293971AI046073TENU1109T. cruzi epimastigote normalized cDNA Library


Date: 4:26:16 on Wed 22 Nov 117.