EST 1785471 is a singleton


Sequence

>1785471 (1 EST) Length=371 GGTTTACCCATGTCAATTTTTAAATTAAAATTCCTTTAATATTGTAAATGATAAAAGCCAATAAACGCAACACCTGCAAA AACATTCGCCATAATTGTGGTAGCCGCAGCCAATTTAAAACATTTTAATTGCAACCATGGAATTCATCGAAATATAATTT TNGTATTCACCAAAATATTTAAATACTGCATTATAATGATTGCAGCGATTCATTTTTTTCCGCATCCCAGCGCCACCAAG CGTACATTCCATTTACCTTTAGAATTCTACCTCGCACCCCTTCCTCCATCGACTCGTGGCTGCCCCTCTTCCTTGTTTTT GCGGTCCTTTCCTACCTAATTCCTGCTTTTAATGCTAATCTTTGCGCTGCG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1785471: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17854713293977AI046079TENU1165T. cruzi epimastigote normalized cDNA Library


Date: 7:29:26 on Sun 19 Nov 117.