EST 1785497 is a singleton


Sequence

>1785497 (1 EST) Length=308 ATAAAGATTGCACACGCCGCGCATGGCTCTGCATTTGACGCTATTGACGTGGGGGACGCACAGGGGTTCACCGACTGCTT TGGCCTTGCACGCACAGTGGCGGGGGGCGACGATGTGCAGCAGTTCCTTCGCGAGCGGCGACTACAAGTCATGGAGGAAC TTGACTACCACGCACTACTGCTGAATTACGGCGTGAAGGAGAGAGGACAGTTGGCATACATGTCATCTCGCTTTGCCATG AAAATTTTGCGGCGGTACAAGAAGAGCTGGCGCANATTTTGCAAAACTACGTGACGCTGATGCCGAAG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 1785497: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17854973294003AI046105TENU1191T. cruzi epimastigote normalized cDNA Library


Date: 0:39:55 on Sat 25 Nov 117.