EST 1785504 is a singleton


Sequence

>1785504 (1 EST) Length=377 CTTCCGTGGAACCTTCCGAGGGTGAAGAGGAAGAAGAGAGCGTTATCACATTCGCTTCATCAAGTTCGCCCCTTCCACGT TTCTCAGCAGCCTTGCAGGAAAAAAAGTTCGTTAGCATCGTCTGTCGACCACGATTTTTGCCTTCCACTTCAGAAAGTTT TTTAAAAAAGCCAATAGTCAGCGTCACCGCATTAATCATTATACCAGGATTCCTTACAAAAGTTGCCAAAACAATCTGCA TGGTGGCGGCGATCAGAGTTTCCGTTGTCACCAACTCCGGTAAGGCCAATGTATTATTCGAGACACCGCCTAGCTGGCGA AGACCTTGGTTTCCAAGTTTCACATTGAGCCTTTGTCCCTTTGCGTTGTTGGTCTCA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1785504: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17855043294010AI046112TENU1198T. cruzi epimastigote normalized cDNA Library


Date: 19:31:50 on Mon 20 Nov 117.