EST 1785522 is a singleton


Sequence

>1785522 (1 EST) Length=385 CACGTCGAGGCCACTGACATCCATATTCTCATTGTGCTCCACCTGGAAGGCAAAACGAAAGTCACGCGTGAATACCCCAG ATGGCAGTTGCAATCGCCATTCCACGATGCCTCCGTTATCCACACTGCAGTCGTTGTCATCCACTTTCGCACACTCAGTT AGCATATTCTTGCTTGGTTCAATGAGTCTCACCGTAATTTCCTTGTGCGAGGAGACGGGGCACTGGTCCTTCACCACCAA GGTCGCCTCTGCCGTCAATGAGCTCTTCACGGTAAATTCGTACACATATTCAATGACTTTTTTTCGGTTGCGCACATGGC ATGTAGAGTAGACTTAGCCCGCTTCACTTGTTTCCGTGTTACTTTCACAGCATCATCTGTACCAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1785522: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17855223294028AI046130TENU1216T. cruzi epimastigote normalized cDNA Library


Date: 19:2:28 on Thu 23 Nov 117.