EST 1785525 is a singleton


Sequence

>1785525 (1 EST) Length=504 AAGACATGCATATATGTATACATCTCTCTTTTTTTTTTTTTTTTTTCTTTTCCCCATGTGTGTGTTTGTTTACAGAATAT GAATGGTGCCATTTTTCCAATGACTCCTCGTGCCGGATGCGGGTCTATCTACATCGGTGAACACACAGCCAACAAACACA CATATACGCACACCCGCACCCGCACAGAGTGAAACAACAAAAAGGCAAAGGACGATCATAGACATCGACATGTATGCATA AATCTCTTCACCTTCCTAGTCGTTGCTGCATACGAACCAACCGTACCGTCAGTTCTGACGCTTTCATATTTTCAAACGGT GTGGGAGGTCTTGCGGCAGGTCGTGGCGGCGATAAAATTCCGCCATACCTCGAAAGATGATTCTGTACGTCTTTCTTCTT GCTGATCGTTTCCATGTGCTGGGTACCGAGCGCTCTGATGGGTTCGTTCGAAGAGGCATGAGAAAAAACTGAAGGTGGGC GCTTTGATTTGGGCGGCACGTCAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1785525: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17855253294031AI046133TENU1219T. cruzi epimastigote normalized cDNA Library


Date: 13:14:58 on Wed 22 Nov 117.