EST 1785534 is a singleton


Sequence

>1785534 (1 EST) Length=462 AATGCTGCGTCAAATTGATATGTACTCCATGTCCGGTCGAATGGTTGTCACCCCAACACAATGAACCCCCTGGTCTGATG GCTGTGTAAGAATGGCACGTCCAGCTACACCCACAGCATTTGCTGCCTGAATCATTGCCTCAGCAACACTCTCAGCAATG CGCTCGCCTCTCGGCTGAGTCAAGGGATCGCCGTGTCGGCCACCTACAAGTGCACACACTGAGGGTCCAGCACCTGAAAG AAAGGCGTAGTGGGCTCCAGCAGCCATGGCGGCATCGACACAAGGACGAAAATGAGGGAAAAGGGCATCAGCCGTTGCTT TTGGTGCAGTTTGTCATCACAAGATTTGAGCAAGCGAAGATCCCCGGTACAGAGCGCCAGTACAAGAATGGAGGAACGGG AAATATTAAAAACGGTATCTTCGAGCGAAACACTGCTTGGAATTAGATTACGAGTTGCGTGC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 1785534: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17855343294040AI046142TENU1228T. cruzi epimastigote normalized cDNA Library


Date: 16:19:7 on Fri 17 Nov 117.