EST 1785535 is a singleton


Sequence

>1785535 (1 EST) Length=200 GTCACACCGCAGACAACAATCGCTAACAAAAAACATAAAAACCAAACACAATCAAACAAACAAAAAAATGCCACTAAAAG GCAGTTTCACACACTTCCTTGTTGAGCTTTGGAGGAGGGGCGTCCTCGAAAGAAACACCACGACGACGCGCCGGGCCATT GTAGTCAAATGGAAACATGCCGTTGTACTTTGCCCACGGC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1785535: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17855353294041AI046143TENU1229T. cruzi epimastigote normalized cDNA Library


Date: 2:41:35 on Mon 20 Nov 117.