EST 1785537 is a singleton


Sequence

>1785537 (1 EST) Length=327 AAAGAGGAGCTCCCGCTACTTCTGCTCGGTTTCACCCGCTTCACAACCGGTAATGCCGCGTGGGGAACTCCCGTCGCAGC CAACACCACCCCACTGCTGTATGATGGGCCCACAGGCACAGCCGGTGGAGGGGGCGTATATGGAGGTCCACTGAGCCGGG GTTCTAGGCCTATTGTTGTGGGAGGTGGTGCTTGTTGTTGTGATGCGCGCGAAAAATCCACCGGAACTGCCACTGGAACG CTCGGATATGACGATAACGGTGGCGGATGTCCTGATTCCGACCGTGACACAATCGAGGGCGTGGATACACTTGTTCCCAG TGCGGTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 1785537: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17855373294043AI046145TENU1231T. cruzi epimastigote normalized cDNA Library


Date: 16:0:11 on Fri 17 Nov 117.