EST 1785538 is a singleton


Sequence

>1785538 (1 EST) Length=333 CTCCACGAGGAGGAGAAAAACAACAACAACAAAAACTCAATAACAATTCTTACTTCCTAACACACACATGAATGCACAGA GTGAGAGAGATAGTGGCAGTAATACTAAGCATAAGAAAGATCAGAGCGACGGTATCAGATCCCACCATAGTGCTTCTGGC ACCGATATTCCCACGCCAAAAGCTCATCACGTGCAATTCGTACCGTGAGTCATTGTGCAACCGCATCCAATCCCTGTCCT GTTCCCACGTCGCACCCCAGTCGCCGTGGGGGATGCGCACGACTTTGGCACCGCTGGAGACCGTGCGACGTCTGTCCAGC CGATGCGATGAAG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1785538: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17855383294044AI046146TENU1232T. cruzi epimastigote normalized cDNA Library


Date: 3:59:23 on Sun 19 Nov 117.