EST 1785542 is a singleton


Sequence

>1785542 (1 EST) Length=120 ACATCAACGTATACATACCGTTTATGTGCTGCATTGTTGATTCCCGCATTATTCTTTTTTTAAATAATTCAGACGAATTT ACTCCCTTCGTTTTGTCCCCCATTTTCTTTTTTCTTCTTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1785542: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17855423294048AI046150TENU1236T. cruzi epimastigote normalized cDNA Library


Date: 22:15:28 on Sat 18 Nov 117.