EST 1785548 is a singleton


Sequence

>1785548 (1 EST) Length=131 CTGGGCTGCTGGCCGAATCCCGAGTTTCCTAATAATAGAAACCAAACCAGATAGGAATAAGAAAACGGATGAATGAAATA AGAATGGATTCACCATACCCTCAAAGTTTCAAAACAAGTATATATATATAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Processing,


Cluster Information for 1785548: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17855483294054AI046156TENU1242T. cruzi epimastigote normalized cDNA Library


Date: 18:41:55 on Sat 18 Nov 117.