EST 1785550 is a singleton


Sequence

>1785550 (1 EST) Length=422 GATGGTCAACGTCAAACAAATAAAANAAAAAAAAGATGATGAAGATGAAAACACGGCAGGTCCCCGAGAGCCACTTTTAG TTTGACACGTGCCCTTGACGCTCGACAAGATCCGTTAGCTGCTCCAGCGCCGCCTCGCTCACCTCACACTGTTCGTCCCG CCCTGCAATCTCACTCAGAGCCCGAAATGCCATTACACCCACCGCAGGTCAAGAGACGCGTAACACCAGTGACGATGCAC AACCGCGCGGTGGTACACAAATGCGGCGTAATTCTGAAAGTCGTGTCTTAATCCCCGTATGGACCGCTCAATCACCGTCA GCCCATCGACACCGACCAGGAGGCAGCTTCCATGATCGGAAACGGCAAGCGAAAGGCGGAGATACACGGGGGCCGCCTGG TGCCTCATCGATACCGGCAGCG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1785550: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17855503294056AI046158TENU1244T. cruzi epimastigote normalized cDNA Library


Date: 9:26:20 on Sun 19 Nov 117.