EST 1785570 is a singleton


Sequence

>1785570 (1 EST) Length=240 CCTCTCTCCTGTCTGTGTCAAGATCGCACAAACAGCAACAAATAAAACAACAACAGAAAAACTCTCCCTTCCTATTTGTT CTTGTCATCTTCCATGGCATCCTCAAAGTATGTTGCCTCGCGATACCACTGCAGCGCATGATACGTCATGTACGCCCCGC CTATGCCGTAGCGCACGTAGTCTGGAAAGAGTCGTTGTGTGTACAGTAGCCGCACATTTGGGCCAAATGTAAAGATGAAG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1785570: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17855703294076AI046178TENU1265T. cruzi epimastigote normalized cDNA Library


Date: 15:30:3 on Fri 24 Nov 117.