EST 1785575 is a singleton


Sequence

>1785575 (1 EST) Length=240 AGGCATCTTCCACTGACCCCGCTGGCTCGTCCACCTCAGCCGCCGAGGGGAAAGTGGAAGAAGTGGCATCCAGCAGTGTT GGCTCGGCGTCCTCATTCTCTCCAACAGCGGGAGAAGACAGTCCTCAAAAAGTACGTGAAGCCGATGTCCCTGCCACTGA GGATCACTTTGAACGTGAACAGGTGCACTCGTCTCTCAGCGTGGTTCAGCCGATGACGGAGCAGGCTGAAGAGGCGGCTG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 1785575: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17855753294081AI046183TENU1270T. cruzi epimastigote normalized cDNA Library


Date: 17:25:19 on Wed 17 Jan 118.