EST 1785579 is a singleton


Sequence

>1785579 (1 EST) Length=488 CTTACTTTCAAGCAAACGTTGTCAGAGAGAAATACCCATCATAGCTTCACAGAAATGGAACACTTCTCTCCATCTAATCG GTGTCTGACCCTCATCGTTGCAAGCCATGAAGTCCCCCAATGCATCCACAAACTGAGCTGTTGCGCAACCGCCAAAACGG CCGCACAACGACAACAGCCTGCACCGTCGCTCGTGGGCGCATTGCATTTACTCGGCATGGCTTCCAGCAAACACGTCGCC AAAAAATACAGACGCGGTGGGTGGGCTGCCGTAATGAGAAACGCCGCAAGAGCCACACAATTCCTAATTCTTGCGTGGCC ACAACCAAAATAGTCTCGCGGGGATACGGAGCCAAAAACACATCAGCAAATGAGACAAATTCCCGGTGCGGCACAACGAG GGCACCATCTCCGCGGAGAAGTAGTTTGTGGAACCATGCACTCAGGAACCGCGCGGATGGGAACGAAAGCCCACACATCC GCCTCACC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1785579: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17855793294085AI046187TENU1274T. cruzi epimastigote normalized cDNA Library


Date: 6:14:37 on Sun 19 Nov 117.