EST 1785592 is a singleton


Sequence

>1785592 (1 EST) Length=383 GCTTCACACACTCACTCACAAACACACACGCAGACAGATGGAAAAGAGGGAAATAGAGACTGTATGTATGTGTGTTTGTT TGTGTGTGTGTATGCGGAAGGAACTCAACAACACGATGTATGCACCATAATTTCAGTGACCCAAACCACAGATGTCACGA ACAACTCGGTTCAGCCACACCACATCATGTGGGATGCATGTGCTTCTTCTCTCTCTTCCTCTCCCTCCCCTCACTTTCCT TCTAGCAGCCTAAAACGCCAACAACTTTTGTTGATTCTTAAAGACATTCATGTACATGTCCCATTCTCTGTTCATAAAGA TGCAGAGCTCAATACTCTTGTCCTGCCGTAACAGGTACTCCCGATCAAAGATGTGCAATTGCT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1785592: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17855923294098AI046200TENU1287T. cruzi epimastigote normalized cDNA Library


Date: 23:18:36 on Mon 20 Nov 117.