EST 1785599 is a singleton


Sequence

>1785599 (1 EST) Length=230 GAGCCTGGAGTTTCCTACCCATGATGGCCCACGTGGCCAACCTCCTTGTCCATACTATCCAACCATGGTTTAATTGGCGT AGATTGAACAATTTCTTCATAGACGCGGTGTCCTCTAACAGATTGAAGAACGCCGTAAGTGTCCAAATCCGCAAGATCTG GTTTTGAGCCACCGTGAAACTTTTTCTTCCCACCCAAAAGGGCTTTTTCAATAAGGTGTTTATCTCACCA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 1785599: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17855993294105AI046207TENU1294T. cruzi epimastigote normalized cDNA Library


Date: 20:46:48 on Wed 22 Nov 117.