EST 1785604 is a singleton


Sequence

>1785604 (1 EST) Length=494 CACTTTTCAGCGGAAAGGTCAAAATCAGCACCCACCCTCTTTTTGGTGCCCACCGTCTCCTCTTGCCACGCCCCCTCATT CCGTATGCATTTGTTCGGACGACTTGTTGTACGGTCGGAGGCGCTTAAAATGACATTCTATCATTTTCGTAAAAGCCGAC TGAAACGCCGCCGCCCACGCCGCTTCATCTGTCGCGTATCGTTCTGTTAAACTTCGCCATTTTTTATTGCGTAACAGGGC TTCCACCTCGCGTCGGTTAAAGACACATTGCCGCTTTTTTTGTTTCTTTCCCACATGTGCATAAACACAGACGAAGTCCT TTGGGAGGCGTTGGATGACCTTGTTTTCCTCTGTCCGAGGCACTTCCAGCTCAAAGAATCGCCTTTCATTCGCCAACAGA AATTTGTAATAGTCGTTGCTGAGTTTGTACTGACTACCAATGTGTGACACGCCGTCGATGCCGCTTACGTGCTCGTGGAA TTCCCCGACGCCGT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1785604: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17856043294110AI046212TENU1299T. cruzi epimastigote normalized cDNA Library


Date: 18:38:56 on Sat 18 Nov 117.