EST 1785614 is a singleton


Sequence

>1785614 (1 EST) Length=398 AAAACTTTCCAGAAAGATATATAAAAGGAGCAAAGTAAATTTCAAAAAAGTAACCTACATACTTTCACCTTGGCGTTGAA AAGGCCTAATCATGGCATACATGAATACCGCAACAGAATTTTCAAGAATATTCCGGTACCGCCTATCAGTGCCTTCATTC TTGCTCCCCGTGGGTGCCGGTTTGTTGGTCCCCTTCACCTGTAATTTTGCCTGATTCGATGAATACTTGCTTTCTTGTGA TCCCAAGTCGGCGCTTTTTTTTTCTTGTGGAAAAGGGGTTAATTAGATGTGATCCGGAAGAGATAATAAAATACATGTCG TCTTCTCCATGGATCCAAAATTTTATACAGTATGAAAGGTGGATAAGGTGGCCGGCGTCGCGGCACCTGCTGAGTCGC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1785614: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17856143294120AI046222TENU1309T. cruzi epimastigote normalized cDNA Library


Date: 18:22:39 on Fri 17 Nov 117.