EST 1785618 is a singleton


Sequence

>1785618 (1 EST) Length=374 AATAATAATTCAGTGAAATAATAAAACACACACACAAAAAGAGTGAATACTCAACAAAGTGTGGAGGGATTGCACCGTGA ATGCTGCGGAATAAAAGGCGTCCCTCCCCATTTCTCCCCCTTTAATTATTCCTCGTTCTCTCAATCCATGGAGCGAAAAG GTGGTGCGGTGTCAGCCTCACAACGCGTATAAAACTATTCCCCATTAAATACACCCACGCGAGGCAAAAACACCTCCGAG ACAGCAGTCCTCTTCAATGCTGAAGAAAAAAAAAACAATAACGGCGACCATATACAAAATTTCAGACAACCAACACTCTC ACCAAGACGTTCGTAAACAAACAAACAAACAAAAAAGCGGAAAGAACTATATCA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1785618: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17856183294124AI046226TENU1313T. cruzi epimastigote normalized cDNA Library


Date: 3:59:20 on Sat 18 Nov 117.