EST 1785623 is a singleton


Sequence

>1785623 (1 EST) Length=308 GGTATTTGAAGCAAGGTGGAGCATCAACAATTTGCGTAGTCTTTTAACTGCAATTGCTTCGCTTATTCCCACGCAATTTG AAGTTTTCATTTTTCCTTTGGCATCCAAATAATTTCTTGTGCCCCAAACATCCTTGGATCTCAATGTCAAAACTTTCGTC GACTGGCATGTGGATCAACAAGTGAGTTTAGCCAGGAGATTGATTCCAATGTAAGAGAGTCTCGTGAACTTCTGACCCCT TCTTCTTCGACCCCGGGAACTTGAGAAGACAATACAGGTACGAGAAGCGTTGTTTTACTTGCCAGATC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1785623: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17856233294129AI046231TENU1318T. cruzi epimastigote normalized cDNA Library


Date: 0:5:39 on Thu 23 Nov 117.