EST 1789545 is a singleton


Sequence

>1789545 (1 EST) Length=263 GTTATTTTGTTTGTTTGTTATTAAGCTTCACTGTTTTTTAATGTTCGCTCCTAGTTACCTCCTCCATTAGTCCCTCCCTC CATGTATCCTCCATGATATTTCACTTGGGTCCGAAAGCACACGTCATATCCCCAGAGTGAGGCAGTCTCTTTGTTCTACT CCTCTCCTCCCTCCTCGTTTCACTTCCAAGAAGTTATTCTTAACATGTGCGGATCCACTCACTCTACTTACCCGCCCGGC CACCACAGCACAAACAGACGATT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1789545: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17895453299212AI050095TENU1334T. cruzi epimastigote normalized cDNA Library


Date: 9:34:43 on Sun 19 Nov 117.