EST 1789546 is a singleton


Sequence

>1789546 (1 EST) Length=363 ACAGACAACATCCAAGATTCGCCTACAAATCAAAACAAACAACAATAAATGCCTCACCCCCCAAGGAGAATGTAGGCGCA ATAAAAAAAGAATTTCATAAAAATTTCATCGGTTTGTCCTAAAGCCCCCAAGTCAAACTAGCATATCGCATGCCGCACCT CAAGAGATCATTATGGTTAAAAAGAAAACACTGTCTTTTGCACGCAAGAATGCATCAACATATTGCGGACAGCCAATGCG ATCACTCAAGCATGTCGTGCTTGGCGCAATGTGTGCCGCCCTCAAAACGCACGCGGTGGCGCGTTCATCCGCCACCCTTT TTGTGATTGAAAAGGCAGTGATAATGAGGAGTAGGGCACCAAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1789546: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17895463299213AI050096TENU1335T. cruzi epimastigote normalized cDNA Library


Date: 14:27:35 on Sun 19 Nov 117.