EST 1789548 is a singleton


Sequence

>1789548 (1 EST) Length=398 CCCCAGTCCGTCCCATATATATATCTAAATACCGGATAGAGGTAGACACTTCAGAAATGAGGCCTGTTTAAGAGTTCACA TGTGTTTTATGTCTCCAGAACATCAGTATTGGCAAAATACGGCAGCATAATGCCTTCGCGCCACGTTATTTTTCTCCTTA CTGCAAGCAACATCTTGCCAATATCCCCGTGACAGACAAGCAGTACACATTTTCCAGCAAAGTTGGCGTCCACACGCTGT AAAACACGGGCAGCACGATCATAGCATTCGTCAAACGTTTCCGCCCCATCGACAGAAAGAAAATACAAGACCCTGTCCCC TTGTACGACATTTTCCCCGGCGTGCGTTCTGATCTGTTCCATAGGCTTTCCCGTCAGCACACCAAATTCACGCTCCAC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1789548: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17895483299215AI050098TENU1338T. cruzi epimastigote normalized cDNA Library


Date: 11:37:55 on Wed 22 Nov 117.