EST 1789553 is a singleton


Sequence

>1789553 (1 EST) Length=381 TTCATTTTGAAAATGTGCCAAAGGCTCTTGATTTTATCAGCGAGAGGTGGCATTTGTCCTCTGCCACGGTCCCGCGTTAT TTGATCACCTTCAAGCTGGAAACGGAGGAGGAGACATTGAAGAAGAAAGCGCTACAAAACCTCTTCAAATATAAATGCGA TGCGGTTGTGGCAAATATGCTGCAGAACTACCGGGAGCGGGTAGTGTTGTACTGGAAGAGGGAGGAACATCAGCCGGTTC CTTTACTGCGACCAGAAGTCGGTTCCTTTGAGGCACTTATTGTGGATGCATTCCTGGAGCGCATCGAGAAGGAAATGTCG AAGAATGCAGAGTCCATCCAATAATGCCATGGCGAGGCATACGATATGCCGGGGTGGCGGA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 1789553: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17895533299220AI050103TENU1344T. cruzi epimastigote normalized cDNA Library


Date: 2:13:35 on Wed 22 Nov 117.