EST 1789557 is a singleton


Sequence

>1789557 (1 EST) Length=111 AATTACAGTATCAGTACTAGCCAACTCCCTTTCAGAAAGATATTTCTCCGCATCAGCTAAAGCCCAAAACACAGGTATTA CACGTTTTTATATTTCTTTTTTTTTTCTCCA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1789557: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17895573299224AI050107TENU1348T. cruzi epimastigote normalized cDNA Library


Date: 10:47:31 on Sat 18 Nov 117.