EST 1789576 is a singleton


Sequence

>1789576 (1 EST) Length=428 ACGGTGGAGGGGCACATCTCTATGTGCATGTGTGTTCGTGTGTATTTGTCAAAGACGGACAAGATGGACGAGCGAGCGGC TAAAACATGCAAAAAAAATANTAATCATAAATGATAAAAGGAGAACATTTCATTTGTCACCTCCGTTAATTCTTGCGCTT CGCCTATTGCCACTCACTGCGTCGTGTCAAACTGAAATTCCATCCCATCCCCAAGCGACATCACCCCCTTATCATCATCA TCATCATCGCTGCCCTCCTCTTGCGTGCCAAACAAGTCGAGCAGCTCCTCGTCCGTCAGGCCCGCCGTCAGGGTGGGGCC AAAGTCTAACGTCTCTGCAGAAAATTCTCCGAAACTGATGGGAAAAGGTGGCGCAGGCGCAAGAGACCTTTTCTCCGTGG ATCCCTTCAGCAACTCGTGTGACGGTGT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 1789576: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17895763299243AI050126TENU1370T. cruzi epimastigote normalized cDNA Library


Date: 20:59:50 on Sun 19 Nov 117.