EST 1789585 is a singleton


Sequence

>1789585 (1 EST) Length=285 TGTCCGTGCAGTGCCATATGCCATGAGAATGCCATGAGATGTTGACACAAAGTCTCCACCACTCGCAGCCCCACCCTTCA CGTCCTGCAGTATGTGGTTAAAATCACCCGAGGCTCCACAGGCTCGTAAATACCGAAGTGTCTCGCTGATTTCTGAACTG CGGTGTTCCCTGCCGTACTTGGGCATCGGCAAAACAATATCGTAGTGTTGAAAAATAAGATCTGCAGTGAAGAGGCATTC ATGATACGGACAAGTTCGCATCTCATGAATTTGTTCCTAGTGCCG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1789585: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17895853299252AI050135TENU1380T. cruzi epimastigote normalized cDNA Library


Date: 4:12:18 on Mon 20 Nov 117.