EST 1789600 is a singleton


Sequence

>1789600 (1 EST) Length=377 AAAAATAGTAAAGAAAAAAAAAAGGAAACAAAAAGCTACACAAGCGAAATACACATATTCTCTCATGTACACGGCTAAAC CATCTTTTTATTATCATTTGGACGCACTTCCTTCTGTTTGCGTGTTTTCCTGTTTGTGTGGTTTCATTTCTCCAATAAGC AAGAAAAATAACCATTGTTGTCCCTGAATCCCACAGTTAGAAAGGAAGCTCAGAGAAAGTGATGAATGCGTCTGTCATGA GGAGACTCGAGGAATGCAAGGTATCATACAAAGAATAGGTCTCGTACACATGAAAGGCCAATTGGATGCCTACATGAAGA CGTGTGCGGTCAAGGCGGTAAAGCGACACCAATGCTGCGCCAATTGGTGTCTCATCA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1789600: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17896003299267AI050150TENU1395T. cruzi epimastigote normalized cDNA Library


Date: 10:28:31 on Sat 18 Nov 117.