EST 1789604 is a singleton


Sequence

>1789604 (1 EST) Length=409 TCTTCTCTCCGTTGGTGGAAAGAGCGCCTTCCCGCGCCGCCAACGCATATCGGAGCGCGCCCCGCAACGCCAGCGACGTT CCCGCAGAGCGCGCGCCGGACGCGGAGGCCGCGGCGAAAAACACACGTGGGGGCCGGCGTTGCGCGTATCACGGTCGATT GCCGGGCCTGTCGGGCAGGGGCGACACCGCCAGTCACCTCCGCGCCGCCCAGGGTCGTGTGGGCGGACCGGGCGGCATAC CATTCGGAGGCCTCCAGCACAAAGCGAAGAGCCCAACGGAGACCGCCGTGGCGTGGTGTCGGGGCCTCTTCCCGTATTCC CGGGGAAGCCGGAGCCAGCAGTGTTTCCCTCGCGGGNTTGCGCTGTTGCCGCGCAGGTCCGAGTAGTAGGGCGTACGTGC TTCACAATG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1789604: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17896043299271AI050154TENU1399T. cruzi epimastigote normalized cDNA Library


Date: 17:25:34 on Wed 22 Nov 117.