EST 1789612 is a singleton


Sequence

>1789612 (1 EST) Length=278 CAGACAAAACACTGAGGTACATGCAGAAGATTTAAACAAGTGTCTTGGAGAGTCGGGATGTTATGATTAAAAAAAAAAAT CTATATGCATGCTCGCTCTATTTCTGCTTCAGGAGCTGCATGACACCGGCAGCAAACGCCTCCAAGTGCACAATGGTCTT CGTGCCAAGCTTCATGTTGTGGTCGTACTGCGCCGCAAGAGCGACAAGAGGCCGTCGAAGTGCGGGATCGACCGCAGACA TCAGCTTCTCGAGAACCAAGCGAAGAATTAACTCGCCG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 1789612: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17896123299279AI050162TENU1407T. cruzi epimastigote normalized cDNA Library


Date: 17:10:17 on Fri 24 Nov 117.