EST 1789633 is a singleton


Sequence

>1789633 (1 EST) Length=326 AAGAAAGACAGTTACCGCGTGATACCTACATAATATATATATATGTACTTTGCGCGGAGTGCATTGGAGTTGTGATGGCC TCTTTTTTTCTTTTTTCTTTTTTCTCTTCTTCCACTTCTTCCCGCCCACATTGACCAGACAAATTGACGGGAATGAAGGC ATCCGAAGTAAAAAAATGGGTCACGGCCTCCAATGGACCCGCCGGTGAAGGGGGAAAAGTAACCAAAAAGGGGGTAATTA CATTATTGGGAGAGTGAGAAGAAGAAAAAGGAAGAGGGCAAATATTGCGGACGCAGAAATACAGACAAAACCAACAACAA CAACAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1789633: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17896333299300AI050183TENU1430T. cruzi epimastigote normalized cDNA Library


Date: 1:26:35 on Sun 19 Nov 117.