EST 1789634 is a singleton


Sequence

>1789634 (1 EST) Length=328 CGCAAGTGTAGCACGTACCAGCGCCTCGCTGGCAAAAAGAGAGCCGTCTCCCTCTCGCCAGCCTTCACTCTCGCCGTTTT GTTGACCTCCATCTCCTGATGTTGTTGCTGCTTCTCAAACACCTCTCGAAGAAACGCCTTCAACGAGGCTGCAGCGCACC CCTCCGCGCGGCCTGCCACAAACCGACTCAACTCTTCCCGTGCTTTCACCGCCGCGCCGTCAAAGGCACCAAAGAACTCC AGTGCCATTTCCTCTGCAGCCTCAAAACTAAGCGGCGGCACGTAAACAACCGTCTCAAAACGTCCCTGTCGCAAGAGGGC GACGTCAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 1789634: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17896343299301AI050184TENU1431T. cruzi epimastigote normalized cDNA Library


Date: 22:23:38 on Thu 23 Nov 117.