EST 1789636 is a singleton


Sequence

>1789636 (1 EST) Length=233 TGATTTTACATCAATTGTGGAAAAATGACGGGTGGTTGTGACGCATTTCACCGCACGGCAGCTTTCCCCTAACCATTTTT ATTTTCCCTTCTTTTCCTCTTTACCGCCGCTCTCTCTCAATATGCATATAAAAAAATATAAATATATATNCNCCCCCCAG TGCTGTCGACTCAGCCGTTTCCATTGACGCTCGACGCGGGAACCAGCGGTGGGGCGCGTGTGTTGGTGTTTAG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1789636: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17896363299303AI050186TENU1433T. cruzi epimastigote normalized cDNA Library


Date: 2:11:51 on Wed 22 Nov 117.