EST 1789655 is a singleton


Sequence

>1789655 (1 EST) Length=390 ACTTCGACGACCGCCGCGGCTTCAATTCCCGTTTCTGGCGCCGCAACGCACTGGACTTGGGCGACGATCGACGCGATCGC TCCGTGAAGAGCACCGCCACGCAGCGCCGCAGGAAGGCGCATTTGAGCGCAACGCTGAAGGAGACTACAAAATTAGAAGG ACTTCTCTTTTCTTTTTTTTTTTTTTTTCTCTTTGTTTGTTTTGTTTTCTTTCCTGCACTCTTTCCTTCACACGGCCAGG CGTCCACCCACCGCGGACGCCTCCTGACATGTTTGTCTTGCTCCTTTTGTCCCAGTGCAGGAGACGAACGAACAGCACCC ACAGGGGAGAGGGAGAGAAGAGTAAGCGAAGGAAAAGGAAGGAATGATCGTGAAGAAATTATGAGCACGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST, Processing,


Cluster Information for 1789655: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17896553299322AI050205TENU1453T. cruzi epimastigote normalized cDNA Library


Date: 6:42:17 on Tue 21 Nov 117.