EST 1789663 is a singleton


Sequence

>1789663 (1 EST) Length=132 CACATGTGGGAAGATAGTCATATAAACACAATAAATGTACCGCTTCAATCCACGTCTTTTTTGTTTTTGTTATTACTTTT GTTTGTTTGTTTGTTTGTTTATTTCTTGTTATTGTCATTTTCTTTTATTTAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1789663: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17896633299330AI050213TENU1461T. cruzi epimastigote normalized cDNA Library


Date: 4:32:2 on Mon 20 Nov 117.