EST 1792607 is a singleton


Sequence

>1792607 (1 EST) Length=251 GATATACGTGTCAGAGGCATCGACGTTAAAGCCACAGCTGCGAGGCCCTCTTCGTGTCTTCTCGCCGCGTAGGGGCTGCT GGGGGCAGGGTCTCTCCACTTCGAGGGGAAACCGCACCAAATTTTCCGTGAAGCACGTCTTCCTCACTTCTCCGGCGTAC ACTCCATGTTTTTCTTTTAATCGATCGCAGATCCAAGCAGCGAAGTGGATGCAGACTTATCTCTTTGCGCAGTTCACACT GGCCGGCTTTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1792607: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17926073320943AI053316TENU1476T. cruzi epimastigote normalized cDNA Library


Date: 21:37:23 on Fri 24 Nov 117.