EST 1792609 is a singleton


Sequence

>1792609 (1 EST) Length=177 CCTCGCCACATCCTCATGCTCCCATGTTGTTGTTGTTGTTTTTGTTTTTGTTTTCTTCTTTTTGGAGCTCCCCCTCCCCC CCCCGCCACCAACTCCGCGGAGGCGATGTAAAGTCGTCGTGCCCGCCAACCAACATGCACCGCTGTGCGTCGTGCGTGAC GGCTCTTGACAACTCAC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1792609: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17926093320945AI053318TENU1478T. cruzi epimastigote normalized cDNA Library


Date: 14:59:39 on Wed 22 Nov 117.