EST 1792611 is a singleton


Sequence

>1792611 (1 EST) Length=163 AAATGCAAAGATAAAATTCACCCTTTTCCACGCCATCATTTCTTTTCCGCGCCACTCAGCAGGTTCTTTCTCACACCAGA CACATTAAAAAACTGGCAATAGACACATAAATAAAAGCAAGTATGTGCGTCCCCAGCCAAAATAATAGGGGGGTGCTAAT TAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1792611: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17926113320947AI053320TENU1480T. cruzi epimastigote normalized cDNA Library


Date: 16:44:36 on Sat 18 Nov 117.