EST 1792612 is a singleton


Sequence

>1792612 (1 EST) Length=285 GTGTGTGTGTCTATTGGGTTTCTTTGATGGCTTTTTTCTTCTTTTTTTTTTTTTCTTCCTTTCTTTCTTTCCTCAATTTC TCTCGTGTGCGTGAAAATAATAATAATAATAATAGTCACCACCGTCGAGGAGGCCATGCCCATGTCTCCTTCCCGTTACA TCAACCCCTGCCAATTTTCTTGTCTTTTTGTTGTTGTTTTTGTTGTTTTCTCTGGCCATCCGTCAAGCCCACTCCATTTT CCCTTCCTTTCCCTTCCATTCCTTCCTCTTCCCCTCTTCTGTTGT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1792612: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17926123320948AI053321TENU1481T. cruzi epimastigote normalized cDNA Library


Date: 17:16:10 on Wed 22 Nov 117.